Experimental
Chemistry
All chemicals (reagent grade) used in this study were purchased from commercial sources. 1H-NMR and 13C-NMR spectra were measured using a Bruker Ascend 400 MHz spectrometer at 25 °C and referenced to TMS. High-resolution mass spectra (HR-MS) were recorded on Fourier transform (FT)-ICR MS (Ionspec, 7.0 T). Analytical TLC was performed on glass-backed silica gel sheets (silica gel 60 Å GF254). All compounds were detected using UV light (254 or 365 nm). All solvents and reagents were analytically pure, and no further purification was required. All starting materials were commercially available. The detailed synthesis procedure of compounds 4a–4d, and the compounds 7a–7e and 9a–9d were presented in supplementary materials.
Synthesis of 10a–10d, 11a–11d, and 12a–12d: Compound 4 (0.2 mmol, 1.0 equivalent (equiv.)), N-hydroxybenzotriazole (HOBT) (27 mg, 0.2 mmol, 1.0 equiv.), and 1-ethyl-(3-(3-dimethylamino)propyl)-carbodiimide hydrochloride (EDCI) (76.4 mg, 0.4 mmol, 1.0 equiv.) were added into a 25-mL flask, followed by the addition of anhydrous N,N-dimethylformamide (DMF) (5 mL). The mixture was stirred for 10 min at room temperature, and then compound 7 or 9 (0.24 mmol, 1.2 equiv.) was added and stirred at room temperature for 2–3 h. With completion of the reaction monitored by TLC, then water (5 mL) was added, followed by extraction with ethyl acetate (15 mL ×5). Next, the organic layers were combined, sequentially washed with water (15 mL) and brine (10 mL), and then dried over anhydrous sodium sulfate. Compound 10–12 were obtained after evaporation to dryness and purification via silica gel column chromatography (DCM/MeOH = 100/1–20/1).
(1R,2R,4S,6R)-6-(((E)-3-(3,4-Diacetoxyphenyl)acryloyl)oxy)-4-((2-(2-(4-(5,7-dihydroxy-4-oxo-4H-chromen-2-yl)phenoxy)acetamido)ethyl)carbamoyl)cyclohexane-1,2,4-triyltriacetate (10a)
Pale yellow foam solid (112.9 mg, yield 56%). 1H-NMR (400 MHz, CDCl3) δ: 12.75 (s, 1H), 9.34 (s, 1H), 7.60–7.57 (m, 3H), 7.39–7.36 (m, 4H), 7.20 (d, J = 6.8 Hz, 1H), 6.80 (d, J = 5.8 Hz, 2H), 6.31 (t, J = 11.6 Hz, 4H), 5.67 (s, 1H), 5.57 (s, 1H), 5.17 (d, J = 9.2 Hz, 1H), 4.39 (s, 2H), 3.59–3.45 (m, 4H), 2.86 (d, J = 13.8 Hz, 1H), 2.75–2.48 (m, 3H), 2.30 (s, 6H), 2.22 (s, 3H), 2.10 (s, 3H), 1.99 (s, 3H); 13C-NMR (101 MHz, CDCl3) δ: 182.0, 171.3, 170.4, 170.3, 169.4, 168.2, 168.0, 167.0, 165.9, 163.7, 163.0, 161.7, 159.7, 157.6, 144.1, 143.8, 142.5, 132.8, 127.9, 126.6, 124.2, 124.0, 122.9, 118.2, 114.9, 104.7, 99.4, 94.5, 81.1, 71.8, 68.2, 67.3, 66.9, 40.7, 38.8, 38.2, 30.7, 21.8, 21.1, 20.7, 20.6, 20.58; HR-MS: C45H44N2O19 + H+, Calcd 917.2617. Found, 917.2607; C45H44N2O19 + Na+, Calcd 939.2436. Found, 939.2413.
(1R,2R,4S,6R)-6-(((E)-3-(3,4-Diacetoxyphenyl)acryloyl)oxy)-4-((2-(4-(4-(5,7-dihydroxy-4-oxo-4H-chromen-2-yl)phenoxy)butanamido)ethyl)carbamoyl)cyclohexane-1,2,4-triyltriacetate (10b)
Pale yellow foam solid (88.3 mg, yield 48%). 1H-NMR (400 MHz, CDCl3) δ: 7.65–7.51 (m, 3H), 7.37–7.35 (m, 3H), 7.25–7.13 (m, 1H), 6.77 (s, 2H), 6.49–6.21 (m, 3H), 5.64–5.55 (m, 3H), 5.13 (s, 1H), 3.96 (s, 2H), 3.76 (s, 2H), 3.43–3.31 (m, 3H), 2.80 (s, 1H), 2.62–2.42 (m, 3H), 2.30 (s, 6H), 2.23 (s, 3H), 2.10 (s, 3H), 1.99 (s, 5H), 1.87 (s, 3H); 13C-NMR (101 MHz, CDCl3) δ: 182.2, 174.6, 172.4, 172.3, 171.4, 170.3, 170.2, 169.9, 168.2, 168.0, 165.7, 163.8, 161.9, 157.7, 144.0, 143.8, 142.5, 132.8, 127.8, 126.6, 124.0, 122.9, 118.3, 114.7, 107.9, 106.6, 106.4, 106.0, 104.7, 103.4, 99.5, 94.4, 81.0, 77.4, 71.8, 68.1, 68.0, 67.7, 29.2, 25.6, 23.9, 22.9, 21.8, 21.0, 20.7, 20.6, 20.58; HR-MS: C47H48N2O19 +H+, Calcd 945.2924. Found 945.2912; C47H48N2O19 + Na+ Calcd 967.2743. Found 967.2750.
(1R,2R,4S,6R)-6-(((E)-3-(3,4-Diacetoxyphenyl)acryloyl)oxy)-4-((2-(10-(4-(5,7-dihydroxy-4-oxo-4H-chromen-2-yl)henoxy)decanamido)ethyl)carbamoyl)cyclohexane-1,2,4-triyltriacetate (10c)
Pale yellow foam solid (70.0 mg, yield 31.3%). 1H-NMR (400 MHz, CDCl3) δ: 7.65 (d, J = 8.2 Hz, 2H), 7.50 (d, J = 15.8 Hz, 1H), 7.30–7.27 (m, 3H), 7.12 (d, J = 8.2 Hz,1H), 6.81 (d, J = 8.0 Hz, 2H), 6.57 (s, 1H), 6.40 (d, J = 16.2 Hz, 2H), 6.31–6.17 (m, 2H), 5.63–5.38 (m, 1H), 5.06 (dd, J = 9.8, 2.8 Hz, 1H), 3.85 (s, 2H), 3.31–3.21 (m, 3H), 2.73 (d, J = 15.0 Hz, 1H), 2.50 (dd, J = 38.6, 12.6 Hz, 2H), 2.32–2.17 (m, 7H), 2.12 (s, 4H), 2.01 (s, 3H), 1.90 (s, 3H), 1.66–1.64 (m, 2H), 1.53–1.51 (m, 2H), 1.36–1.10 (m, 12H); 13C-NMR (101 MHz, CDCl3) δ: 182.4, 177.0, 175.6, 171.5, 170.2, 170.0, 168.2, 168.0, 165.7, 164.2, 163.9, 162.2, 162.0, 157.9, 144.0, 143.8, 142.5, 132.8, 128.0, 126.6, 124.0, 123.0, 122.9, 118.3, 114.9, 104.7, 103.5, 99.6, 94.5, 80.9, 71.8, 68.3, 68.1, 67.1, 40.7, 39.1, 38.0, 36.4, 34.0, 30.9, 29.4, 29.2, 29.0, 25.9, 25.6, 24.9, 21.7, 21.0, 20.7, 20.6, 20.56; HR-MS: C53H60N2O19 + H+, Calcd 1029.3863. Found, 1029.3867; C53H60N2O19 + Na+, 1051.3682. Found 1051.3687.
(1R,2R,4S,6R)-6-(((E)-3-(3,4-Diacetoxyphenyl)acryloyl)oxy)-4-((2-(11-(4-(5,7-dihydroxy-4-oxo-4H-chromen-2-yl)phenoxy)undecanamido)ethyl)carbamoyl)cyclohexane-1,2,4-triyltriacetate (10d)
Pale yellow foam solid (80 mg, yield 35.2%). 1H-NMR (400 MHz, CDCl3) δ: 7.65 (d, J = 8.0 Hz, 2H), 7.51 (d, J = 15.8 Hz, 1H), 7.31–7.23 (m, 3H), 7.13 (d, J = 8.2 Hz, 1H), 6.81 (d, J = 8.2 Hz, 2H), 6.51 (s, 1H), 6.40 (d, J = 15.8 Hz, 2H), 6.32–6.18 (m, 2H), 5.56–5.45 (m, 2H), 5.14–4.94 (m, 1H), 3.84 (s, 2H), 3.33–3.22 (m, 3H), 2.86 (d, J = 30.5 Hz, 1H), 2.73 (d, J = 15.8 Hz, 1H), 2.50 (dd, J = 40.2, 13.1 Hz, 2H), 2.22 (s, 7H), 2.13 (s, 4H), 2.01 (s, 3H), 1.91 (s, 3H), 1.64 (s, 2H), 1.53 (d, J = 5.2 Hz, 2H), 1.40–1.11 (m, 12H); 13C-NMR (101 MHz, CDCl3) δ: 182.4, 175.5, 171.3, 170.2, 169.9, 168.1, 168.0, 165.6, 164.1, 162.9, 162.0, 157.9, 144.0, 143.8, 142.5, 132.9, 128.0, 126.6, 124.0, 122.9, 118.3, 114.9, 104.8, 103.7, 99.7, 94.4, 81.0, 71.8, 68.1, 67.0, 60.4, 40.8, 39.2, 38.1, 36.7, 36.4, 30.9, 29.2, 25.9, 25.6, 21.8, 21.0, 20.7, 20.6, 20.56; HR-MS: C54H62N2O19 + H+, Calcd 1043.4020. Found, 1043.4021.
The synthesis procedure of 11a–11d was described as above:
(1R,2R,4S,6R)-6-(((E)-3-(3,4-Diacetoxyphenyl)acryloyl)oxy)-4-((4-(2-(4-(5,7-dihydroxy-4-oxo-4H-chromen-2-yl)phenoxy)acetamido)butyl)carbamoyl)cyclohexane-1,2,4-triyl Triacetate (11a)
Pale yellow foam solid (110.0 mg, yield 37.5%). 1H-NMR (400 MHz, CDCl3) δ: 12.71 (s, 1H), 9.53 (s, 1H), 7.68 (d, J = 8.2 Hz, 2H), 7.57 (d, J = 15.8 Hz, 1H), 7.40–7.32 (m, 2H), 7.23–7.19 (m, 1H), 7.04–6.82 (m, 3H), 6.59 (s, 1H), 6.39–6.29 (m, 4H), 5.63 (d, J = 2.8 Hz, 1H), 5.54 (td, J = 10.4, 4.6 Hz, 1H), 5.13 (dd, J = 10.2, 2.8 Hz, 1H), 4.49 (s, 2H), 3.34–3.26 (m, 2H), 3.19–3.15 (m, 1H), 2.98–2.83 (m, 1H), 2.66–2.45 (m, 3H), 2.30 (s, 6H), 2.18 (s, 3H), 2.08 (s, 3H), 2.01–1.95 (m, 4H), 1.63–1.45 (m, 4H), 1.34–1.28 (m, 2H); 13C-NMR (101 MHz, CDCl3) δ: 182.2, 170.6, 170.2, 169.9, 169.7, 168.2, 168.1, 165.8, 163.9, 163.2, 161.9, 159.9, 157.7, 144.1, 143.8, 142.5, 132.8, 128.0, 126.6, 124.6, 124.0, 122.9, 118.3, 115.1, 104.7, 104.1, 99.5, 98.7, 94.5, 81.1, 71.7, 68.1, 67.2, 50.6, 39.5, 38.9, 38.2, 30.8, 28.9, 28.7, 23.8, 21.7, 21.0, 20.7, 20.6, 20.57; HR-MS: C48H50N2O19 + H+, Calcd 959.3081. Found, 959.3016; C48H50N2O19 + Na+ Calcd 981.2900. Found 981.2802.
(1R,2R,4S,6R)-6-(((E)-3-(3,4-Diacetoxyphenyl)acryloyl)oxy)-4-((5-(2-(4-(5,7-dihydroxy-4-oxo-4H-chromen-2-yl)phenoxy)acetamido)pentyl)carbamoyl)cyclohexane-1,2,4-triyl Triacetate (11b)
Pale yellow foam solid (70 mg, yield 23.6%). 1H-NMR (400 MHz, CDCl3) δ: 12.61 (s, 1H), 9.35 (s, 1H), 7.62 (d, J = 8.2 Hz, 2H), 7.51 (d, J = 15.8 Hz, 1H), 7.31–7.28 (m, 2H), 7.13 (d, J = 8.2 Hz, 1H), 6.83 (d, J = 7.6 Hz, 3H), 6.44 (s, 1H), 6.35–6.32 (m, 2H), 6.26–6.22 (m, 2H), 5.56 (d, J = 2.8 Hz, 1H), 5.46 (td, J = 10.4, 4.6 Hz, 1H), 5.05 (dd, J = 10.4, 2.8 Hz, 1H), 4.42 (s, 2H), 3.26–3.16 (m, 2H), 3.10–3.05 (m, 1H), 2.90–2.76 (m, 1H), 2.55–2.43 (m, 3H), 2.22 (s, 6H), 2.10 (s, 3H), 2.01 (s, 3H), 1.98–1.85 (m, 4H), 1.80–1.77 (m, 2H), 1.46–1.39 (m, 4H), 1.22–1.17 (m, 2H); 13C-NMR (101 MHz, CDCl3) δ: 182.2, 170.5, 170.2, 169.9, 169.7, 168.2, 168.1, 167.9, 144.1, 143.8, 142.5, 132.8, 128.1, 126.6, 124.7, 124.0, 122.9, 118.3, 115.1, 107.9, 104.8, 104.2, 99.6, 94.4, 81.2, 71.7, 68.1, 68.0, 67.2, 39.4, 38.8, 38.3, 30.7, 29.2, 29.1, 25.8, 25.6, 21.7, 21.0, 20.7, 20.6, 20.58; HR-MS: C49H52N2O19 + Na+ Calcd 995.3056. Found 995.3063.
(1R,2R,4S,6R)-6-(((E)-3-(3,4-Diacetoxyphenyl)acryloyl)oxy)-4-((6-(2-(4-(5,7-dihydroxy-4-oxo-4H-chromen-2-yl)phenoxy)acetamido)hexyl)carbamoyl)cyclohexane-1,2,4-triyltriacetate (11c)
Pale yellow foam solid (100 mg, yield 50.2%). 1H-NMR (400 MHz, CDCl3) δ: 12.69 (s, 1H), 9.34 (s, 1H), 7.74 (d, J = 8.6 Hz, 2H), 7.59 (d, J = 16.0 Hz, 1H), 7.42–7.33 (m, 2H), 7.21 (d, J = 8.2 Hz, 1H), 6.94 (d, J = 8.6 Hz, 2H), 6.80 (s, 1H), 6.45–6.43 (m, 2H), 6.40–6.37 (m, 1H), 6.36–6.28 (m, 2H), 5.64 (d, J = 3.2 Hz, 1H), 5.57 (ddd, J = 19.6, 14.8, 3.6 Hz, 2H), 5.13 (dd, J = 10.2, 3.2 Hz, 1H), 4.52 (s, 2H), 3.41–3.08 (m, 4H), 2.93–2.80 (m, 1H), 2.67–2.44 (m, 2H), 2.34–2.30 (m, 8H), 2.18 (s, 3H), 2.08 (s, 3H), 2.05–1.91 (m, 4H), 1.58–1.39 (m, 4H), 1.26 (s, 6H); 13C-NMR (101 MHz, CDCl3) δ: 182.3, 170.4, 170.2, 169.9, 169.6, 168.2, 168.0, 167.9, 165.8, 163.9, 163.2, 162.0, 159.9, 157.7, 144.1, 143.8, 142.5, 132.8, 128.1, 126.6, 124.8, 124.0, 122.9, 118.3, 115.1, 104.8, 104.3, 99.7, 94.4, 81.2, 71.7, 68.1, 67.3, 67.2, 53.5, 39.8, 39.1, 38.3, 30.7, 29.2, 29.2, 28.6, 26.6, 21.7, 21.0, 20.7, 20.6, 20.58; HR-MS: C50H54N2O19 + H+, Calcd 987.3394. Found, 987.3395; C50H54N2O19 + Na+ Calcd 1009.3213. Found 1009.3211.
(1R,2R,4S,6R)-6-(((E)-3-(3,4-Diacetoxyphenyl)acryloyl)oxy)-4-((11-(2-(4-(5,7-dihydroxy-4-oxo-4H-chromen-2-yl)phenoxy)acetamido)undecyl)carbamoyl)cyclohexane-1,2,4-triyltriacetate (11d)
Pale yellow foam solid (110.0 mg, yield 51.2%). 1H-NMR (400 MHz, CDCl3) δ: 7.73 (d, J = 7.8 Hz, 2H), 7.52 (d, J = 16.0 Hz, 1H), 7.33–7.29 (m, 2H), 7.15 (d, J = 8.2 Hz, 1H), 6.92 (d, J = 8.3 Hz, 2H), 6.56–6.53 (m, 1H), 6.42 (d, J = 20.4 Hz, 2H), 6.33–6.16 (m, 3H), 5.62–5.41 (m, 2H), 5.06 (dd, J = 10.2, 3.6 Hz, 1H), 4.49 (s, 2H), 3.27–3.26 (m, 2H), 3.13–3.12 (m, 2H),2.89–2.73 (m, 1H), 2.55–2.44 (m, 2H), 2.23 (d, J = 2.8 Hz, 6H), 2.12 (s, 3H), 2.02 (s, 3H), 1.98–1.87 (m, 5H), 1.43–1.35 (m, 4H), 1.18–1.05 (m, 16H); 13C-NMR (101 MHz, CDCl3) δ: 182.3, 170.3, 170.1, 169.8, 169.5, 168.1, 167.9, 167.8, 167.0, 163.9, 163.3, 162.1, 159.9, 157.8, 144.2, 143.9, 142.5, 132.8, 128.2, 126.6, 125.0, 124.0, 122.9, 118.2, 115.2, 104.9, 104.4, 99.7, 94.5, 81.3, 71.7, 68.1, 67.3, 39.9, 39.2, 38.4, 30.7, 29.7, 29.5 (2C), 29.3 (2C), 29.2, 29.17, 26.8, 21.7, 21.0, 20.7, 20.6, 20.55; HR-MS: C55H64N2O19 + H+, Calcd 1057.4182. Found, 1057.4187.
The synthesis procedure of 12a–12d was described as above:
(1R,2R,4S,6R)-6-(((E)-3-(3,4-Diacetoxyphenyl)acryloyl)oxy)-4-((2-(2-(2-(4-(5,7-dihydroxy-4-oxo-4H-chromen-2-yl)phenoxy)acetamido)ethoxy)ethyl)carbamoyl)cyclohexane-1,2,4-triyltriacetate (12a)
Pale yellow foam solid (65 mg, yield 44.2%). 1H-NMR (400 MHz, CDCl3) δ: 12.73 (s, 1H), 7.66 (d, J = 8.2 Hz, 2H), 7.57 (d, J = 15.8 Hz, 1H), 7.38–7.36 (m, 3H), 7.21 (d, J = 8.2 Hz, 1H), 6.99 (s, 1H), 6.89 (d, J = 8.2 Hz, 2H), 6.39–6.30 (m, 4H), 5.74–5.49 (m, 2H), 5.15 (d, J = 7.4 Hz, 1H), 4.55 (s, 2H), 3.57–3.55 (m, 7H), 3.31 (s, 1H), 2.89 (d, J = 15.8 Hz, 1H), 2.61 (dd, J = 41.0, 13.6 Hz, 2H), 2.30 (s, 6H), 2.18 (s, 3H), 2.08 (s, 3H), 2.05–1.94 (m, 4H); 13C-NMR (100 MHz, CDCl3) δ: 182.2, 170.7, 170.2, 169.9, 169.7, 168.3, 168.2, 168.1, 163.9, 163.0, 161.7, 160.0, 157.7, 144.3, 143.9, 142.5, 132.7, 128.0, 126.7, 124.4, 124.1, 123.0, 118.1, 115.1, 104.8, 104.1, 99.6, 94.6, 81.1, 71.6, 69.7, 69.4, 68.1, 67.5, 67.3, 39.7, 39.1, 38.4, 30.7, 21.6, 21.0, 20.7, 20.64, 20.60; HR-MS: C47H48N2O20 + H+, Calcd: 961.2897. Found, 961.2881; C47H48N2O20 + Na+, Calcd 983.2693. Found, 983.2697.
(1R,2R,4S,6R)-6-(((E)-3-(3,4-Diacetoxyphenyl)acryloyl)oxy)-4-((2-(2-(2-(2-(4-(5,7-dihydroxy-4-oxo-4H-chromen-2-yl)phenoxy)acetamido)ethoxy)ethoxy)ethyl)carbamoyl)cyclohexane-1,2,4-triyl Triacetate (12b)
Pale yellow foam solid (104.0 mg, yield 52%). 1H-NMR (400 MHz, CDCl3) δ: 12.73 (s, 1H), 9.12 (s, 1H), 7.72 (d, J = 8.0 Hz, 2H), 7.57 (d, J = 15.9 Hz, 1H), 7.38–7.35 (m, 2H), 7.24–7.15 (m, 2H), 6.91 (d, J = 7.8 Hz, 2H), 6.74 (s, 1H), 6.44–6.30 (m, 4H), 5.64–5.54 (m, 2H), 5.13 (d, J = 7.6 Hz, 1H), 4.52 (s, 2H), 3.62–3.52 (m, 12H), 2.87 (d, J = 15.8 Hz, 1H), 2.58 (dd, J = 40.0, 13.4 Hz, 3H), 2.30 (s, 6H), 2.19 (s, 3H), 2.09 (s, 3H), 2.00 (s, 3H); 13C-NMR (100 MHz, CDCl3) δ: 182.2, 170.6, 170.2, 169.9, 169.6, 168.2, 168.1, 168.0, 165.8, 163.6, 163.1, 162.0, 159.8, 157.7, 144.1, 143.8, 142.5, 132.8, 128.0, 126.6, 124.7, 124.0, 122.9, 118.2, 115.1, 104.9, 104.2, 99.5, 94.4, 81.1, 71.7, 70.2, 70.1, 69.5, 68.1, 67.2, 39.5, 38.9, 38.2, 30.8, 21.6, 21.0, 20.7, 20.64, 20.60; HR-MS: C49H52N2O21 + H+, Calcd 1005.3135. Found, 1005.3134; C49H52N2O21 + Na+, Calcd 1027.2955. Found, 1027.2954.
(1R,2R,4S,6R)-6-(((E)-3-(3,4-Diacetoxyphenyl)acryloyl)oxy)-4-((1-(4-(5,7-dihydroxy-4-oxo-4H-chromen-2-yl)phenoxy)-2-oxo-6,9,12-trioxa-3-azatetradecan-14-yl)carbamoyl)cyclohexane-1,2,4-triyltriacetate (12c)
Pale yellow foam solid (67.0 mg, yield 43.7%). 1H-NMR (400 MHz, CDCl3) δ: 12.72 (s, 1H), 9.14 (s, 1H), 7.73 (d, J = 7.6 Hz, 2H), 7.58 (d, J = 16.0 Hz, 1H), 7.39–7.35 (m, 2H), 7.25–7.11 (m, 2H), 6.92 (d, J = 7.4 Hz, 2H), 6.78 (s, 1H), 6.52–6.23 (m, 4H), 5.73–5.47 (m, 2H), 5.12 (d, J = 7.4 Hz, 1H), 4.53 (s, 2H), 3.73–3.43 (m, 15H), 3.37 (s, 1H), 2.86 (d, J = 15.8 Hz, 1H), 2.57 (dd, J = 41.0, 14.2 Hz, 3H), 2.31 (s, 6H), 2.18 (s, 3H), 2.08 (s, 3H), 1.99 (s, 3H); 13C-NMR (100 MHz, CDCl3) δ: 182.2, 170.6, 170.2, 169.8, 169.6, 168.2, 168.0, 167.9, 165.8, 163.6, 163.1, 162.1, 159.8, 157.7, 144.0, 143.8, 142.5, 132.8, 128.0, 126.6, 124.7, 124.0, 122.9, 118.3, 115.1, 104.9, 104.3, 99.6, 94.3, 81.0, 71.8, 70.4, 70.2, 70.1, 69.6, 68.1, 67.2, 67.1, 39.6, 39.0, 38.2, 30.8, 21.6, 21.0, 20.7, 20.64, 20.6; HR-MS: C51H56N2O22 + Na+, Calcd 1071.3217. Found, 1071.3214.
(1R,2R,4S,6R)-6-(((E)-3-(3,4-Diacetoxyphenyl)acryloyl)oxy)-4-((1-(4-(5,7-dihydroxy-4-oxo-4H-chromen-2-yl)phenoxy)-2-oxo-6,9,12,15-tetraoxa-3-azaheptadecan-17-yl)carbamoyl)cyclohexane-1,2,4-triyltriacetate (12d)
Pale yellow foam solid (48.0 mg, yield 30.0%). 1H-NMR (400 MHz, CDCl3) δ: 12.72 (s, 1H), 9.12 (s, 1H), 7.76 (d, J = 5.0 Hz, 2H), 7.58 (d, J = 15.8 Hz, 1H), 7.36 (s, 2H), 7.23 (s, 2H), 6.95 (d, J = 4.8 Hz, 2H), 6.85 (s, 1H), 6.55–6.23 (m, 4H), 5.64–5.57 (m, 2H), 5.11 (d, J = 9.8 Hz, 1H), 4.54 (s, 2H), 3.72–3.45 (m, 19H), 3.36 (s, 1H), 2.86 (d, J = 15.2 Hz, 1H), 2.68–2.48 (m, 3H), 2.31 (s, 6H), 2.19 (s, 3H), 2.09 (s, 3H), 1.99 (s, 3H); 13C-NMR (100 MHz, CDCl3) δ: 182.2, 170.6, 170.2, 169.8, 169.6, 168.2, 168.0, 167.8, 165.7, 163.6, 163.2, 162.1, 159.9, 157.7, 144.0, 143.8, 142.5, 132.8, 128.1, 126.6, 124.8, 124.0, 123.3, 122.9, 118.3, 115.2, 105.0, 104.4, 99.6, 94.3, 81.0, 71.8, 70.4, 70.2, 70.15, 69.7, 68.1, 67.3, 67.1, 39.6, 39.0, 38.3, 30.8, 21.6, 21.0, 20.7, 20.64, 20.60; HR-MS: C53H60N2O23 + Na+, Calcd 1115.3479. Found, 1115.3481.
In Vitro XOD Inhibitory Activity Screening
Different concentrations (0, 6.25, 12.5, 25, 50, and 100 µM) of CA conjugates and the positive control allopurinol (Innochem, Beijing, China) were added to a 67-mM phosphate buffer solution (pH = 7.4) containing XOD (Sigma-Aldrich, Wuhan, China, activity of 20 nM, 5 mU/mL). The mixture was preincubated at 37 °C for 15 min, 50 mM xanthine (Innochem, Beijing, China) was added, and the absorbance at 295 nm was immediately measured once every minute, for a total of 30 min. The percentage of inhibition rate (%) was calculated using the following formula, and the drug concentration required to achieve 50% inhibition rate was calculated as the IC50 value:
Dimethyl sulfoxide (DMSO) was used to dissolve the test compound and allopurinol; hence, DMSO was used as the negative control.
NO Production Assays
RAW264.7 cells were cultured in a 96-well plate at a density of 5 × 104 cells per well with a final volume of 200 µL. The cells were then incubated with various CA conjugates at a concentration of 10 µg/mL for 2 h. Next, LPS (1 µg/mL, Sigma-Aldrich, U.S.A.) was added and incubated for another 24 h. The production of NO was quantified by measuring the accumulation of nitrites in the culture medium using the colorimetric Griess reaction, with minor adjustments. Then 100 µL of supernatant medium, was combined with an equal volume of Griess A (0.1% (w/v) N-(1-naphthyl)-ethylenediamine dihydrochloride) and B (1% (w/v) sulfanilamide containing 5% (w/v) H3PO4) (1 : 1) at room temperature for 10 min in the dark. The absorbance was promptly measured at a wavelength of 540 nm.
MTT Assay
RAW264.7 cells were seeded in a 96-well plate in triplicate at a density of 5 × 104 cells per well, with a final volume of 200 µL. The cells were then incubated with or without CA conjugates for 2 h. Next, LPS (1 µg/mL, Sigma-Aldrich) was added and incubated for another 24 h, followed by the addition of 20 µL of MTT (5 mg/mL) to each well and incubation for 4 h at 37 °C. After removing the supernatant, 200 µL of DMSO was added to facilitate the dissolution of formazan crystals. The absorbance of each well was measured at a wavelength of 492 nm using a microplate reader (Tecan Infinite 200 Pro, Switzerland).
RNA Isolation and Quantitative Real-Time PCR (qRTPCR) Analysis
Total RNA was isolated from RAW264.7 cells treated with different concentrations of CA conjugates in the presence of LPS (1 µg/mL) and ATP (Sigma-Aldrich, 5 mM) using Trizol reagent (Life Technologies, 15596018). One microgram of total RNA was subjected to synthesize cDNA using PrimeScript™ First-Strand cDNA Synthesis kit (TaKaRa, Beijing, China). The real-time PCR was performed using qTOWER 3G (Analytic Jena, Jena, Germany) with 2XM5 HiPer SYBR Premix Es Taq kit. The reactions of the Samples were then run in triplicate and Internal β-actin gene was used as a reference. Relative expression differences of PCR results were calculated by the comparative cycle threshold method. PCR was performed with specific primers NLRP3, IL-1β, and TNF-α (Table 2).
Table 2. PCR Primers Used in This Study
| Primer name | Primer sequence |
|---|---|
| β-Actin-F | AAATCGTGCGTGACATCAAAGA |
| β-Actin-R | GCCATCTCCTGCTCGAAGTC |
| IL-1β-F | TGCCACCTTTTGACAGTGATG |
| IL-1β-R | AAGGTCCACGGGAAAGACAC |
| TNF-α-F | CGTCAGCCGATTTGCTATCT |
| TNF-α-R | CGGACTCCGCAAAGTCTAAG |
| NLRP3-F | AAGGCTTGTGTGGGACCAAA |
| NLRP3-R | AGGAGGGGCAGGAGTAAGAG |
ELISA
RAW264.7 cells (2 × 106/well) were cultured in a 6-well plate overnight and then treated with various concentrations (6.25, 25, and 100 µM) of 10d and Isoliquiritigenin (ISL, Innochem, Beijing, China, 25 µM) for 1 h, followed by stimulation with LPS (1 µg/mL) for 5 h and ATP (5 mM) for another 1 h. Cell culture supernatants were collected and added into ELISA plates for the determination of IL-1β levels (BIOSTER, Wuhan, China) according to the manufacturer’s instructions. Each sample was tested in triplicate.
Western Blotting
RAW264.7 cells (2 × 106/well) were cultured in a 6-well plate overnight and then pretreated with different concentrations (6.25, 12.5, 25, 50, and 100 µM) of 10d and ISL (25 µM) for 1 h, followed by stimulation with LPS (1 µg/mL) for 5 h and incubation with ATP (5 mM) for an additional 1 h. The cells were harvested and lysed in a radio immunoprecipitation assay (RIPA) lysis buffer (Solarbio, Beijing, China) on ice for 30 min, and the supernatant was collected. Proteins were quantified using the enhanced bicinchoninic acid (BCA) protein assay kit (Elabscience, Wuhan, China), and equal amounts of protein (40 µg) were separated via 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred onto polyvinylidene difluoride (PVDF) membranes (Millipore, CA, U.S.A.). The membranes were blocked with 5% skim milk at room temperature for 1 h and then incubated overnight at 4 °C with primary antibodies specific for NLRP3 (ABclonal, Wuhan, China), caspase-1 (ABclonal), and IL-1β (Elabscience, Wuhan, China), and iNOS (ABclonal), COX2 (Bioworld Technology, Inc, MN, U.S.A.), glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (Bioworld Technology, Inc, MN, U.S.A.), followed by washing with TBST and incubation for an additional 1 h with goat anti-rabbit immunoglobulin G (lgG)/HRP (Bioss, Beijing, China). Then, the membranes were analyzed using the Super ECL Plus kit (US Everbright Inc., Suzhou, China) for imaging with ChemiScope 3000 mini (Clinx, Shanghai, China).
Protein Structure Prediction and Molecular Docking
The structure of the XOD protein was downloaded from the PDB database (PDB code: 3NVY), the structure of NLRP3 was predicted using AlphaFold2. Firstly, UCSF Chimera was used to add hydrogens, and the AMBER14SB force field was employed to calculate the atomic charges of the protein.38,39) The three-dimensional structure of compound 10d was generated using the open-source cheminformatics software package RDKit, the AM1-BCC model was employed to assign partial charges to the low-energy conformations of 10d, AutoDock 4.2 software was employed for Molecular docking. The SiteMap software was utilized to predict the binding sites of the ligands, the predicted binding sites were designated as the docking center, with a box size set to a cube measuring 22.5 Å on each side. The spacing searching parameter was set to 0.375 Å, the maximum limit for searching conformations was set as 10000, and the Lamarckian Genetic Algorithm (LGA) was employed for conformation sampling and scoring.40–42)
Statistical Analysis
Parallel experiments were repeated three times, Statistical analysis comparing LPS-stimulated cells to controls was performed using the two-sided unpaired t-test. To compare the effect of different concentrations of CA conjugates in LPS-stimulated cells, one-way ANOVA followed by a Dunnett’s multiple comparison test was used. The statistical tests were applied using GraphPad Prism, version 8.0.1 (GraphPad Software, San Diego, CA, U.S.A.).
